Stem-loop sequence aja-mir-25

AccessionMI0024364 (change log)
DescriptionArtibeus jamaicensis miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
       a ug   ag    g     uu g     u   --  ac 
5' ggcc g  uug  aggc gagac  g gcaau gcu  gg  g
   |||| |  |||  |||| |||||  | ||||| |||  ||  c
3' ccgg c  gac  ucug cucug  c cguua cgg  cc  u
       c gu   ag    g     uu a     -   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-25

Accession MIMAT0031142
Sequence

52 - 

cauugcacuugucucggucuga

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).