Stem-loop sequence aja-mir-143

AccessionMI0024369 (change log)
DescriptionArtibeus jamaicensis miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   --------------   ag      g         g      u  -  ag 
5'               ccc  ccugag ugcagugcu caucuc gg uc  u
                 |||  |||||| ||||||||| |||||| || ||   
3'               ggg  gggcuc augucacga guagag cu ag  u
   cgucuugucgaaga   aa      g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence aja-miR-143

Accession MIMAT0031147
Sequence

45 - 

ugagaugaagcacuguagcucg

 - 66

Get sequence
Evidence not experimental

References

1
PMID:23166587 "Transcriptome sequencing and annotation for the Jamaican fruit bat (Artibeus jamaicensis)" Shaw TI, Srivastava A, Chou WC, Liu L, Hawkinson A, Glenn TC, Adams R, Schountz T PLoS One. 7:e48472(2012).