Stem-loop sequence stu-MIR6026

AccessionMI0020256 (change log)
DescriptionSolanum tuberosum miR6026 stem-loop
Gene family MIPF0001554; MIR6026
Literature search

1 open access papers mention stu-MIR6026
(2 sentences)

Stem-loop
   -----ugac     uu                auu       c    cu c              a u         --auug         u      -     u uaacuuauuuuucuuu     a 
5'          cacuu  auuugguaauacaacu   gccaaga aaug  u auuauaagugcaua c uuucacuuu      uuugagcau guguug auuuc c                gaaca a
            |||||  ||||||||||||||||   ||||||| ||||  | |||||||||||||| | |||||||||      ||||||||| |||||| ||||| |                |||||  
3'          gugaa  ugaaccguuauguuga   cgguucu uuau  a uaauguuuacguau g aaagugaga      agacucgua cacaac uaaag g                uuugu a
   guuaauuuu     -c                gau       u    au u              c u         gauuga         c      g     c ---------cuacuuu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137959.1: 711491-711732 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR6026
stu-MIR8011aJH137959.1: 709134-709230 [+]
stu-MIR6026JH137959.1: 711491-711732 [+]
Database links

Mature sequence stu-miR6026-5p

Accession MIMAT0031164
Sequence

19 - 

aauacaacuauugccaagacaa

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence stu-miR6026-3p

Accession MIMAT0023609
Sequence

201 - 

uucuuggcuagaguuguauugc

 - 222

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22307647 "MicroRNA regulation of plant innate immune receptors" Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P, Baker B Proc Natl Acad Sci U S A. 109:1790-1795(2012).
2
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).