Stem-loop sequence stu-MIR5304

AccessionMI0025883 (change log)
DescriptionSolanum tuberosum miR5304 stem-loop
Gene family MIPF0001713; MIR5304
Stem-loop
   --       a          a  acau         caug 
5'   caaugca cauacucauc cc    cuuucaucu    u
     ||||||| |||||||||| ||    |||||||||     
3'   guuacgu guaugaguag gg    gaaaguaga    g
   ag       g          a  cauu         aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138090.1: 77646-77725 [+]
intergenic
Database links

Mature sequence stu-miR5304-5p

Accession MIMAT0030974
Sequence

1 - 

caaugcaacauacucaucacc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR5304-3p

Accession MIMAT0031236
Sequence

60 - 

agaugaguauggugcauugga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).