Stem-loop sequence mmu-mir-8093

AccessionMI0026020 (change log)
Symbol MGI:Mir8093
DescriptionMus musculus miR-8093 stem-loop
Stem-loop
   agagaag  g       uu   -a   -    ---    gagu   --u          --     -  u    g  u 
5'        gu agugucu  ccu  gcc cugu   gucu    ccu   ggggagcaga  gcaug ag ggag gg u
          || |||||||  |||  ||| ||||   ||||    |||   ||||||||||  ||||| || |||| ||  
3'        cg uuacggg  gga  ugg gacg   cagg    gga   ccucucgucu  cgugu uc ccuc uc c
   ------g  g       -u   gg   u    guc    ---u   cau          uu     g  -    g  c 
Get sequence
Deep sequencing
88 reads, 2.63 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 32687630-32687766 [-]
sense
OTTMUST00000029798 ; Fpgs-006; exon 2
OTTMUST00000029794 ; Fpgs-002; exon 6
OTTMUST00000029793 ; Fpgs-001; exon 7
OTTMUST00000029800 ; Fpgs-008; exon 7
OTTMUST00000029801 ; Fpgs-009; exon 8
ENSMUST00000156792 ; Fpgs-006; exon 2
ENSMUST00000130164 ; Fpgs-002; exon 6
ENSMUST00000028148 ; Fpgs-001; exon 7
ENSMUST00000146498 ; Fpgs-008; exon 7
ENSMUST00000127812 ; Fpgs-009; exon 8
Database links

Mature sequence mmu-miR-8093

Accession MIMAT0031394
Sequence

41 - 

uuggggagcagagcaugagug

 - 61

Get sequence
Deep sequencing59 reads, 27 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1