Stem-loop sequence mmu-mir-8110

AccessionMI0026042 (change log)
Symbol MGI:Mir8110
DescriptionMus musculus miR-8110 stem-loop
Stem-loop
   -------au   g    -        g      cag   uu    agg      c 
5'          gcu uugc cuccccuu cccuaa   ccg  uguu   cuuaau u
            ||| |||| |||||||| ||||||   |||  ||||   ||||||  
3'          cga aacg gggggggg gggguu   ggu  gcga   gaguua g
   aucgaaacc   -    u        g      --a   --    --a      a 
Get sequence
Deep sequencing
60 reads, 4.76 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 89024735-89024831 [+]
intergenic
Database links

Mature sequence mmu-miR-8110

Accession MIMAT0031416
Sequence

57 - 

aagcguggauugggggggggg

 - 77

Get sequence
Deep sequencing15 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1