Stem-loop sequence ppe-MIR827

AccessionMI0026140 (change log)
DescriptionPrunus persica miR827 stem-loop
Gene family MIPF0001769; MIR827_5
Literature search

1 open access papers mention ppe-MIR827
(2 sentences)

Stem-loop
   u       u           c     c  cu   -     uu g 
5'  guuuguu auggucaucua uuauu ug  uca guauu  u u
    ||||||| ||||||||||| ||||| ||  ||| |||||  | a
3'  caaacaa uaccaguagau aguaa ac  agu uauaa  a c
   a       c           u     u  --   a     uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 22179391-22179478 [-]
intergenic
Database links

Mature sequence ppe-miR827

Accession MIMAT0031516
Sequence

68 - 

uuagaugaccaucaacaaaca

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).