Stem-loop sequence ppe-MIR1511

AccessionMI0026145 (change log)
DescriptionPrunus persica miR1511 stem-loop
Gene family MIPF0001743; MIR1511
Literature search

1 open access papers mention ppe-MIR1511
(3 sentences)

Stem-loop
   auc               u        c   uu  cac   a 
5'    gugguaucagaguca guuauuug aug  gc   cac u
      ||||||||||||||| |||||||| |||  ||   |||  
3'    uaccauagucucggu caauaaau uac  cg   gug a
   caa               c        a   -u  -uu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 9435160-9435243 [+]
intergenic
Database links

Mature sequence ppe-miR1511-5p

Accession MIMAT0031521
Sequence

3 - 

cgugguaucagagucauguua

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR1511-3p

Accession MIMAT0031522
Sequence

64 - 

accuggcucugauaccauaac

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).