Stem-loop sequence ppe-MIR7122a

AccessionMI0026148 (change log)
DescriptionPrunus persica miR7122a stem-loop
Gene family MIPF0000771; MIR1509
Literature search

1 open access papers mention ppe-MIR7122a
(1 sentences)

Stem-loop
       ucu    ca       -uc   -caaa       uuc               u    u      c    aa   ac   -   u  u 
5' uuca   uuug  aaaucaa   gau     ggguuca   cauuuuuuuauacaa gaaa cacggc gaga  aga  aga aga uc u
   ||||   ||||  |||||||   |||     |||||||   ||||||||||||||| |||| |||||| ||||  |||  ||| ||| || u
3' aggu   agac  uuuaguu   cua     cccaggu   guagagaaauauguu cuuu gugccg cucu  ucu  ucu ucu ag c
       --u    ag       uuc   acuug       cau               u    -      u    cc   -c   c   c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 2253872-2254049 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR7122a
ppe-MIR7122bchrG1: 2244304-2244423 [+]
ppe-MIR7122achrG1: 2253872-2254049 [+]
Database links

Mature sequence ppe-miR7122a-5p

Accession MIMAT0031527
Sequence

47 - 

uuauacaaugaaaucacggccg

 - 68

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR7122a-3p

Accession MIMAT0031528
Sequence

114 - 

gccguguuucuuuguauaaag

 - 134

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).