Stem-loop sequence ppe-MIR6274b

AccessionMI0026161 (change log)
DescriptionPrunus persica miR6274b stem-loop
Gene family MIPF0001706; MIR6274
Stem-loop
        ac  u            -  a                    a   ua 
5' ggaua  ac guuuugcuauuu cg cuaauaacacaaugauacgu aaa  a
   |||||  || |||||||||||| || |||||||||||||||||||| |||   
3' ccuau  ug uaaaacgauaaa gc gguuauuguguuacuaugca uuu  c
        aa  c            a  c                    c   uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 3795314-3795418 [-]
intergenic
Database links

Mature sequence ppe-miR6274b-5p

Accession MIMAT0031552
Sequence

19 - 

auuucgacuaauaacacaaug

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR6274b-3p

Accession MIMAT0031553
Sequence

68 - 

uuguguuauuggccgaaaauag

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).