Stem-loop sequence bbe-mir-200c

AccessionMI0026197 (change log)
DescriptionBranchiostoma belcheri miR-200c stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   uaaccaccua        g       -     u     gu     - gau 
5'           gcggaguu ugucauc uuacc ggcag  uuaga c   u
             |||||||| ||||||| ||||| |||||  ||||| |    
3'           cgccucag acaguag aaugg cuguc  aaucu g   c
   -----cauaa        g       u     u     ac     a agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-200c-3p

Accession MIMAT0031610
Sequence

58 - 

uaacacugucugguaaugauga

 - 79

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).