Stem-loop sequence bbe-mir-2059

AccessionMI0026202 (change log)
DescriptionBranchiostoma belcheri miR-2059 stem-loop
Gene family MIPF0001683; mir-2059
Stem-loop
   aacacuuguugagcc              -   c      u   u  a 
5'                ccuuucaaagcaaa ugg ugcaau cuu gu u
                  |||||||||||||| ||| |||||| ||| ||  
3'                ggaaaguuucguuu guc acguua gaa ua u
   --------------u              u   -      u   c  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-2059-3p

Accession MIMAT0031617
Sequence

21 - 

caaagcaaauggcugcaauucu

 - 42

Get sequence
Evidence not experimental

Mature sequence bbe-miR-2059-5p

Accession MIMAT0031618
Sequence

57 - 

uauugcacuguuuugcuuuga

 - 77

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).