Stem-loop sequence bbe-mir-2076

AccessionMI0026219 (change log)
DescriptionBranchiostoma belcheri miR-2076 stem-loop
Gene family MIPF0001795; mir-2076
Stem-loop
   ---------------   u           ag         u  auu 
5'                ugg agaauugcacu  agugauuug ug   u
                  ||| |||||||||||  ||||||||| ||    
3'                acc ucuugacguga  ucacuaaac ac   u
   cggaacacguucggu   u           cu         u  agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-2076-5p

Accession MIMAT0031642
Sequence

7 - 

aauugcacuagagugauuuguu

 - 28

Get sequence
Evidence not experimental

Mature sequence bbe-miR-2076-3p

Accession MIMAT0031643
Sequence

41 - 

caaaucacuucagugcaguucu

 - 62

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).