Stem-loop sequence bbe-mir-281

AccessionMI0026230 (change log)
DescriptionBranchiostoma belcheri miR-281 stem-loop
Gene family MIPF0000087; mir-46
Literature search

1 open access papers mention bbe-mir-281
(2 sentences)

Stem-loop
   uuucccgccucugu              cu         u  cgaa u 
5'               gcggaagggagagc  uuccgugac gu    c u
                 ||||||||||||||  ||||||||| ||    |  
3'               cgccuuuucucucg  gagguacug ca    g c
   -------------g              uu         u  caag g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-281-5p

Accession MIMAT0031660
Sequence

21 - 

gggagagccuuuccgugacugu

 - 42

Get sequence
Evidence not experimental

Mature sequence bbe-miR-281-3p

Accession MIMAT0031661
Sequence

59 - 

ugucauggaguugcucucuuuu

 - 80

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).