Stem-loop sequence bbe-mir-4891

AccessionMI0026265 (change log)
DescriptionBranchiostoma belcheri miR-4891 stem-loop
Gene family MIPF0001856; mir-4891
Stem-loop
   --u    ----       a       cu           g   c  g 
5'    ggcu    guuuggg agaugag  guucugcuacg cug gu u
      ||||    ||||||| |||||||  ||||||||||| ||| || c
3'    ccgg    caaaccc ucugcuc  caggacgaugc gau ca a
   ucu    ucug       g       -c           -   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-4891-5p

Accession MIMAT0031708
Sequence

13 - 

aagaugagcuguucugcuacgg

 - 34

Get sequence
Evidence not experimental

Mature sequence bbe-miR-4891-3p

Accession MIMAT0031709
Sequence

50 - 

gcguagcaggacccucgucugc

 - 71

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).