Stem-loop sequence bbe-mir-92a-1

AccessionMI0026272 (change log)
DescriptionBranchiostoma belcheri miR-92a-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   agaaguuagucauga           u        g        uac 
5'                caagaaggucg gauaggug caauguug   c
                  ||||||||||| |||||||| ||||||||   c
3'                guuuuuccggc cuguucac guuauaac   a
   --------------c           c        -        ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-92a-5p

Accession MIMAT0031719
Sequence

21 - 

aggucgugauagguggcaauguu

 - 43

Get sequence
Evidence not experimental

Mature sequence bbe-miR-92a-3p

Accession MIMAT0031720
Sequence

57 - 

uauugcacuugucccggccuuu

 - 78

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).