Stem-loop sequence bbe-mir-92b

AccessionMI0026274 (change log)
DescriptionBranchiostoma belcheri miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -cagaca     uc   g        u    -   u     c    uu     
5'        uggcg  guu cucagguc ggau agu gcaau uucg  cugu 
          |||||  ||| |||||||| |||| ||| ||||| ||||  ||| c
3'        accgc  caa gaguccgg ccug uca cguua aagc  gaca 
   acuuuua     cu   a        c    c   -     c    -c     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-92b-5p

Accession MIMAT0031721
Sequence

21 - 

aggucuggauaguugcaaucuu

 - 42

Get sequence
Evidence not experimental

Mature sequence bbe-miR-92b-3p

Accession MIMAT0031722
Sequence

61 - 

cauugcacucgucccggccuga

 - 82

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).