Stem-loop sequence bbe-mir-92c

AccessionMI0026275 (change log)
DescriptionBranchiostoma belcheri miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ------------------------ugaauggauagggaggggguuuugauugaguguuuuu    a  uua     uuuguuuuu      aa            gaa       cc 
5'                                                              guaa au   gcggu         ggcggg  ggucgggacaag   caauguu  c
                                                                |||| ||   |||||         ||||||  ||||||||||||   |||||||  c
3'                                                              cguu ua   cgccg         ucgccu  ucggcccuguuc   guuauag  a
   cuucuccuuccgacgucuugcccaccgaacuucauuuuucucacggcuucaguucaaacuu    c  --c     ---------      gc            -ac       uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-92c-3p

Accession MIMAT0031723
Sequence

101 - 

uauugcacuugucccggcucg

 - 121

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).