Stem-loop sequence bbe-mir-92d

AccessionMI0026276 (change log)
DescriptionBranchiostoma belcheri miR-92d stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ugu                    g     u      uaa    
5'    gugauugacaggucaggaug agugu augcug   acu 
      |||||||||||||||||||| ||||| ||||||   || u
3'    uauuaacuguccgguccuau ucacg uaugac   ugg 
   cgg                    -     u      -ug    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-92d-5p

Accession MIMAT0031724
Sequence

13 - 

aggucaggauggaguguuaugcu

 - 35

Get sequence
Evidence not experimental

Mature sequence bbe-miR-92d-3p

Accession MIMAT0031725
Sequence

52 - 

uauugcacuuauccuggccugu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).