Stem-loop sequence bbe-mir-4857

AccessionMI0026286 (change log)
DescriptionBranchiostoma belcheri miR-4857 stem-loop
Gene family MIPF0001842; mir-4857
Stem-loop
   cug     -ac        u     cu      --   ag 
5'    ugauc   gauguuuu gucug  ccagag  gug  u
      |||||   |||||||| |||||  ||||||  |||   
3'    acuag   cuacaaag cagac  ggucuc  cac  u
   gca     acu        -     ug      ag   gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-4857-5p

Accession MIMAT0031735
Sequence

9 - 

acgauguuuuugucugcuccaga

 - 31

Get sequence
Evidence not experimental

Mature sequence bbe-miR-4857-3p

Accession MIMAT0031736
Sequence

50 - 

ugggucagacgaaacaucucag

 - 71

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).