Stem-loop sequence bbe-mir-4869

AccessionMI0026287 (change log)
DescriptionBranchiostoma belcheri miR-4869 stem-loop
Gene family MIPF0001829; mir-4869
Stem-loop
   u      ua  a        -ucc cu      --       
5'  uuccgu  cg uguugacu    g  ccucug  ugguaa 
    ||||||  || ||||||||    |  ||||||  ||||| u
3'  aaggua  gc acaacuga    c  ggagau  acuaua 
   -      ca  -        uguc ag      ca       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-4869-5p

Accession MIMAT0031737
Sequence

9 - 

acgauguugacuuccgcuccucu

 - 31

Get sequence
Evidence not experimental

Mature sequence bbe-miR-4869-3p

Accession MIMAT0031738
Sequence

51 - 

agggaccuguagucaacacgaca

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).