Stem-loop sequence hbv-mir-B22

AccessionMI0026327 (change log)
DescriptionHerpes B virus miR-B22 stem-loop
Stem-loop
      -     c       c a   c    cu  ucca 
5' ccc ccgcc uucucuc c gac ccuc  cu    u
   ||| ||||| ||||||| | ||| ||||  ||    c
3' ggg ggcgg gagagag g cug gggg  ga    a
      a     c       u c   a    au  cacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Refseq:NC_004812) Overlapping transcripts
NC_004812: 7402-7475 [-]
intergenic
NC_004812: 118383-118456 [+]
intergenic
Clustered miRNAs
< 10kb from hbv-mir-B22
hbv-mir-B20NC_004812: 125472-125560 [+]
hbv-mir-B26NC_004812: 125347-125404 [+]
hbv-mir-B19NC_004812: 125195-125258 [+]
hbv-mir-B22NC_004812: 118383-118456 [+]
hbv-mir-B14RCNC_004812: 118383-118455 [-]
hbv-mir-B14RCNC_004812: 7403-7475 [+]
hbv-mir-B22NC_004812: 7402-7475 [-]
hbv-mir-B19NC_004812: 600-663 [-]
hbv-mir-B26NC_004812: 454-511 [-]
hbv-mir-B20NC_004812: 298-386 [-]
Database links

Mature sequence hbv-miR-B22-3p

Accession MIMAT0031773
Sequence

45 - 

uaggggaguccgugagagagcgg

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21543500 "Identification and expression analysis of herpes B virus-encoded small RNAs" Amen MA, Griffiths A J Virol. 85:7296-7311(2011).