Stem-loop sequence dre-mir-20b

AccessionMI0001899 (change log)
DescriptionDanio rerio miR-20b stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention dre-mir-20b
(3 sentences)

Stem-loop
      uu     u      -ucca      uc   g     g   ug    
5' gag  ugucc ggcagu     aagugc  aca ugcag uag  cca 
   |||  ||||| ||||||     ||||||  ||| ||||| |||  || g
3' cuu  gcagg ccguua     uucacg  ugu acguc auc  ggu 
      cc     -      ugaac      uc   a     -   ua    
Get sequence
Deep sequencing
32396 reads, 1.18e+03 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr14: 31467167-31467260 [-]
intergenic
KZ115452.1: 23271-23364 [-]
intergenic
Clustered miRNAs
< 10kb from dre-mir-20b
dre-mir-18cchr14: 31467376-31467460 [-]
dre-mir-20bchr14: 31467167-31467260 [-]
dre-mir-19cchr14: 31467026-31467130 [-]
dre-mir-363chr14: 31466671-31466797 [-]
Database links

Mature sequence dre-miR-20b-5p

Accession MIMAT0001778
Previous IDsdre-miR-20b
Sequence

20 - 

caaagugcucacagugcagguag

 - 42

Get sequence
Deep sequencing32198 reads, 11 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence dre-miR-20b-3p

Accession MIMAT0031939
Sequence

56 - 

acugcaaugucugcacuucaagu

 - 78

Get sequence
Deep sequencing197 reads, 4 experiments
Evidence not experimental
Database links

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).