Stem-loop sequence dvi-mir-263a

AccessionMI0009486 (change log)
DescriptionDrosophila virilis miR-263a stem-loop
Gene family MIPF0000122; mir-263
Stem-loop
   --      g   a  ua   g     ga   au       -  uuu 
5'   aucucg cac gu  aug cacug  aga  ucacggg gu   u
     |||||| ||| ||  ||| |||||  |||  ||||||| ||   a
3'   uagggc gug ua  uac gugau  ucu  agugccc ca   u
   ua      -   g  uc   g     uc   --       g  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12963: 13235111-13235199 [+]
intergenic
Database links

Mature sequence dvi-miR-263a-5p

Accession MIMAT0008919
Previous IDsdvi-miR-263a
Sequence

15 - 

aauggcacuggaagaauucacggg

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-263a-3p

Accession MIMAT0032051
Sequence

55 - 

cgugaucucuuaguggcaucua

 - 76

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).