Stem-loop sequence dvi-mir-33

AccessionMI0009507 (change log)
DescriptionDrosophila virilis miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ug       u      -g           c c    u    -cu  a 
5'   gagcugu acggag  ugcauuguagu g auug cugu   ca a
     ||||||| ||||||  ||||||||||| | |||| ||||   ||  
3'   cuugacg ugccuc  acgugacguca c uaac ggcg   gu u
   ca       -      ga           a a    -    ccc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_13049: 22941119-22941210 [-]
intergenic
Database links

Mature sequence dvi-miR-33-5p

Accession MIMAT0008941
Previous IDsdvi-miR-33
Sequence

17 - 

gugcauuguagucgcauuguc

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-33-3p

Accession MIMAT0032067
Sequence

58 - 

caauacaacugcagugcaagc

 - 78

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).