Stem-loop sequence pmi-mir-92a

AccessionMI0025099 (change log)
DescriptionPatiria miniata miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ccacuac    -  g     u   a        a  u     c     uua   aag 
5'        auua ag gcgug cag caggccga au agugu auaug   aca   a
          |||| || ||||| ||| |||||||| || ||||| |||||   |||    
3'        ugau uc ugcac guc guccggcu ug ucacg uaugc   ugu   a
   -------    c  g     c   c        c  u     u     ---   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-92a-3p

Accession MIMAT0032151
Sequence

67 - 

uauugcacuugucucggccugc

 - 88

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).