Stem-loop sequence pmi-mir-92b

AccessionMI0025100 (change log)
DescriptionPatiria miniata miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention pmi-mir-92b
(1 sentences)

Stem-loop
   guacuuugccuucuac  u    c ug       uu      c  c     gu auc 
5'                 ug guug c  guagguc  gacgag gc auguu  c   u
                   || |||| |  |||||||  |||||| || |||||  |    
3'                 ac cgac g  cguccgg  cugcuc cg uauaa  g   u
   ------gguuccauca  u    u gu       cc      a  u     ug gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-92b-3p

Accession MIMAT0032152
Sequence

68 - 

uauugcacucgucccggccugc

 - 89

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).