Stem-loop sequence pmi-mir-92d

AccessionMI0025102 (change log)
DescriptionPatiria miniata miR-92d stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention pmi-mir-92d
(2 sentences)

Stem-loop
   uuggcgca     g         u    u  a        u      c 
5'         guguu uuuaggucg gacg gu caauguug gauuua g
           ||||| ||||||||| |||| || |||||||| |||||| c
3'         cacaa agauccggc cugc ca guuauaac cugaau c
   ------gg     g         c    u  c        -      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pmi-miR-92d-3p

Accession MIMAT0032154
Sequence

62 - 

uauugcacucgucccggccua

 - 82

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).