Stem-loop sequence lva-mir-92a

AccessionMI0025146 (change log)
DescriptionLytechinus variegatus miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -------------   u        u   uu    cc          u  a 
5'              ucu guaggucg gac  gugc  aauauuuuau ua u
                ||| |||||||| |||  ||||  |||||||||| ||  
3'              agg cauccggc cug  cacg  uuauaaagua gu c
   ucuaaacuugggu   u        c   uu    --          c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-92a-3p

Accession MIMAT0032201
Sequence

51 - 

uauugcacuugucccggccuacu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).