Stem-loop sequence lva-mir-92b-1

AccessionMI0025147 (change log)
DescriptionLytechinus variegatus miR-92b-1 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ------------      gu  a     ac    c       ----   u    u 
5'             uugaug  ca gucgg  cgag gcaaugu    ugu ccuu u
               ||||||  || |||||  |||| |||||||    ||| ||||  
3'             aacuac  gu cggcc  gcuc cguuaua    aua ggag u
   uacuaaaaccac      uc  c     cu    a       agcu   c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence lva-miR-92b-3p

Accession MIMAT0032202
Sequence

56 - 

uauugcacucgucccggccugc

 - 77

Get sequence
Evidence not experimental

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).