Stem-loop sequence ssa-mir-143

AccessionMI0026503 (change log)
DescriptionSalmo salar miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -- g         g      u  -  aa 
5'   g ugcagugcu caucuc gg uc  u
     | ||||||||| |||||| || ||   
3'   c augucacga guagag cu ag  u
   cu g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-143-5p

Accession MIMAT0032365
Sequence

1 - 

ggugcagugcugcaucucuggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-143-3p

Accession MIMAT0032366
Sequence

35 - 

ugagaugaagcacuguagcuc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1