Stem-loop sequence ssa-mir-200b-1

AccessionMI0026584 (change log)
DescriptionSalmo salar miR-200b-1 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   --    -     u       c    uuguac 
5'   cauc uuacc gacagug ugga      a
     |||| ||||| ||||||| ||||       
3'   guag aaugg cugucac aucu      a
   uu    c     u       a    ugaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-200b-5p

Accession MIMAT0032479
Sequence

1 - 

caucuuaccugacagugcugga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-200b-3p

Accession MIMAT0032480
Sequence

39 - 

uaacacugucugguaacgauguu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1