Stem-loop sequence ssa-mir-722-1

AccessionMI0026722 (change log)
DescriptionSalmo salar miR-722-1 stem-loop
Gene family MIPF0001612; mir-722
Stem-loop
   --              a  c      guuu  aca 
5'   auuugaaacguuuu gc aaaaau    cc   g
     |||||||||||||| || ||||||    ||    
3'   uagacuuugcaaag cg uuuuug    gg   u
   uu              a  u      ---u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-722-5p

Accession MIMAT0032667
Sequence

1 - 

auuugaaacguuuuagccaaa

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-722-3p

Accession MIMAT0032668
Sequence

46 - 

uuugcagaaacguuucagauuu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1