Stem-loop sequence ssa-mir-92b

AccessionMI0026762 (change log)
DescriptionSalmo salar miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention ssa-mir-92b
(11 sentences)

Stem-loop
   --    g       u      c     uacaa 
5'   aggu ugggaug ggugca uguug     u
     |||| ||||||| |||||| |||||     g
3'   uccg gcccugc ucacgu auaac     c
   cc    -       -      u     ccucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-92b-5p

Accession MIMAT0032711
Sequence

1 - 

aggugugggauguggugcacuguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-92b-3p

Accession MIMAT0032712
Sequence

42 - 

uauugcacucgucccggccucc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1