Stem-loop sequence ssa-mir-93a-1

AccessionMI0026763 (change log)
DescriptionSalmo salar miR-93a-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-93a-1
(9 sentences)

Stem-loop
   --aa        u  g     g   auaaac 
5'     aagugcug uu ugcag uag      u
       |||||||| || ||||| |||      c
3'     uucacgac aa acguc auc      a
   gucc        c  a     -   cagacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-93a-5p

Accession MIMAT0032713
Sequence

1 - 

aaaagugcuguuugugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-93a-3p

Accession MIMAT0032714
Sequence

41 - 

acugcaaaaccagcacuuccug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1