Stem-loop sequence ssa-mir-93a-2

AccessionMI0026764 (change log)
DescriptionSalmo salar miR-93a-2 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-93a-2
(9 sentences)

Stem-loop
   ---aa        u  g     -gua  u ac 
5'      aagugcug uu ugcag    gc g  u
        |||||||| || |||||    || |   
3'      uucacgac aa acguc    cg c  c
   agccc        c  a     aucc  c ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-93a-5p

Accession MIMAT0032713
Sequence

1 - 

aaaagugcuguuugugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-93a-2-3p

Accession MIMAT0032715
Sequence

40 - 

acugcaaaaccagcacuucccga

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1