Stem-loop sequence ssa-mir-8156

AccessionMI0026779 (change log)
DescriptionSalmo salar miR-8156 stem-loop
Stem-loop
   ---   cu   u   c    u   uuua 
5'    guc  gac guc ugac guc    c
      |||  ||| ||| |||| |||    c
3'    cag  cug cag acug cgg    g
   ugu   uc   c   u    u   ucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-8156-5p

Accession MIMAT0032734
Sequence

1 - 

guccugacuguccugacuguc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-8156-3p

Accession MIMAT0032735
Sequence

35 - 

cugucaugaccguccugacugu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1