Stem-loop sequence cel-mir-8191

AccessionMI0026822 (change log)
DescriptionCaenorhabditis elegans miR-8191 stem-loop
Stem-loop
   --   -----    c     c  c   --        c 
5'   ccc     cugc ugggu ac aaa  uguuggca g
     |||     |||| ||||| || |||  ||||||||  
3'   ggg     gaug accua ug uuu  acaaccgu g
   ca   aaccu    a     -  c   ug        u 
Get sequence
Deep sequencing
219 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 5022928-5022995 [-]
sense
C09B9.85 ; C09B9.85; intron 7
Database links

Mature sequence cel-miR-8191-5p

Accession MIMAT0032795
Sequence

1 - 

ccccugccugggucacca

 - 18

Get sequence
Deep sequencing218 reads, 13 experiments
Evidence experimental; Illumina [1], SOLiD [1]
Database links

Mature sequence cel-miR-8191-3p

Accession MIMAT0032796
Sequence

47 - 

guauccaaguaguccaagggac

 - 68

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).