Stem-loop sequence ppc-mir-8213

AccessionMI0026853 (change log)
DescriptionPristionchus pacificus miR-8213 stem-loop
Stem-loop
   --   ga    u  u     au        cuc 
5'   uau  cacc ga gcaga  gauauucu   a
     |||  |||| || |||||  ||||||||    
3'   aua  gugg cu cguuu  cuauaagg   g
   cu   ag    -  -     -c        ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000092.1: 346957-347019 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8213
ppc-mir-2258ABKE03000092.1: 345785-345895 [+]
ppc-mir-8213ABKE03000092.1: 346957-347019 [+]
ppc-mir-8241ABKE03000092.1: 347184-347246 [+]
Database links

Mature sequence ppc-miR-8213-5p

Accession MIMAT0032852
Sequence

1 - 

uaugacaccugaugcagaaugauau

 - 25

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8213-3p

Accession MIMAT0032853
Sequence

42 - 

auccuuugcucgguggaauauc

 - 63

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).