Stem-loop sequence ppc-mir-235

AccessionMI0026854 (change log)
DescriptionPristionchus pacificus miR-235 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --      c  u  ga   c     -   aca 
5'   aggccg gg cg  ugc auguu cgc   g
     |||||| || ||  ||| ||||| |||   u
3'   uccggc cc gc  acg uauaa gcg   c
   ag      -  u  uc   u     u   aag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000090.1: 3355564-3355626 [+]
intergenic
Database links

Mature sequence ppc-miR-235-5p

Accession MIMAT0032854
Sequence

1 - 

aggccgcggucggaugccauguu

 - 23

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-235-3p

Accession MIMAT0032855
Sequence

42 - 

uauugcacucgucccggccuga

 - 63

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).