Stem-loop sequence ppc-mir-8214

AccessionMI0026856 (change log)
DescriptionPristionchus pacificus miR-8214 stem-loop
Stem-loop
   -- ug     c     c     c -  uu 
5'   g  agauu uacca ugaca c ca  a
     |  ||||| ||||| ||||| | ||   
3'   c  ucuaa auggu acugu g gu  a
   ga gu     c     -     u c  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000119.1: 992647-992702 [-]
intergenic
Database links

Mature sequence ppc-miR-8214-5p

Accession MIMAT0032858
Sequence

1 - 

gugagauucuaccacugacacc

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8214-3p

Accession MIMAT0032859
Sequence

36 - 

ugucaugguacaaucuugcag

 - 56

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).