Stem-loop sequence ppc-mir-42c

AccessionMI0026871 (change log)
DescriptionPristionchus pacificus miR-42c stem-loop
Stem-loop
   --gc      u  -    u      uguacauu 
5'     cguaga ac cucg gugagc        c
       |||||| || |||| ||||||         
3'     gcgucu ug gggc cacucg        a
   ucca      u  u    -      uauaacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000092.1: 1773629-1773692 [-]
intergenic
Database links

Mature sequence ppc-miR-42c-5p

Accession MIMAT0032888
Sequence

1 - 

gccguagauaccucgugugagc

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-42c-3p

Accession MIMAT0032889
Sequence

43 - 

ucaccggguguuucugcgaccu

 - 64

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).