Stem-loop sequence ppc-mir-8227

AccessionMI0026876 (change log)
DescriptionPristionchus pacificus miR-8227 stem-loop
Stem-loop
   ---u    a   c          -  aa 
5'     ggua ccg gugcaauuuc ca  c
       |||| ||| |||||||||| ||   
3'     ccau ggc cacguuaaag gu  u
   cgac    g   u          c  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000124.1: 924053-924106 [-]
intergenic
Database links

Mature sequence ppc-miR-8227-5p

Accession MIMAT0032898
Sequence

1 - 

ugguaaccgcgugcaauuucc

 - 21

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8227-3p

Accession MIMAT0032899
Sequence

34 - 

aauugcacucggguacccagc

 - 54

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).