Stem-loop sequence ppc-mir-8228

AccessionMI0026877 (change log)
DescriptionPristionchus pacificus miR-8228 stem-loop
Stem-loop
   --     u      u        c ugu 
5'   aaccg guggcc acugguag g   u
     ||||| |||||| |||||||| |   u
3'   uuggc cacugg uggccauc c   g
   uc     -      c        a uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000039.1: 860756-860811 [+]
intergenic
Database links

Mature sequence ppc-miR-8228-5p

Accession MIMAT0032900
Sequence

1 - 

aaccguguggccuacugguagc

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8228-3p

Accession MIMAT0032901
Sequence

36 - 

uaccggucggucaccgguucu

 - 56

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).