Stem-loop sequence ppc-mir-63j

AccessionMI0026885 (change log)
DescriptionPristionchus pacificus miR-63j stem-loop
Stem-loop
   --c   c      c   u        --   -   g 
5'    cgc cgcuug agu gucauggu  ccu cuu u
      ||| |||||| ||| ||||||||  ||| ||| u
3'    gug gcgaac uca caguauca  gga gag g
   gaa   a      -   -        cc   c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000076.1: 1442729-1442796 [+]
intergenic
Database links

Mature sequence ppc-miR-63j-5p

Accession MIMAT0032916
Sequence

1 - 

ccgcccgcuugcaguugucauggu

 - 24

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-63j-3p

Accession MIMAT0032917
Sequence

47 - 

uaugacacucaagcgagugaag

 - 68

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).