Stem-loop sequence ppc-mir-2238h

AccessionMI0026892 (change log)
DescriptionPristionchus pacificus miR-2238h stem-loop
Gene family MIPF0000822; mir-2238
Stem-loop
   --c   u    c    c    g    uuau 
5'    cgu cacu aacu guca ucga    u
      ||| |||| |||| |||| ||||     
3'    gcg guga uuga cagu agcu    g
   aga   c    c    -    a    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000093.1: 9109494-9109552 [-]
intergenic
Database links

Mature sequence ppc-miR-2238h-5p

Accession MIMAT0032930
Sequence

1 - 

ccguucacucaacucgucaguc

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-2238h-3p

Accession MIMAT0032931
Sequence

38 - 

aaugacaguucagugcgcgaga

 - 59

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).