Stem-loop sequence ppc-mir-8258

AccessionMI0026919 (change log)
DescriptionPristionchus pacificus miR-8258 stem-loop
Stem-loop
   --a     au      c       -  gca 
5'    cgcuc  ucaaga caugaca cg   a
      |||||  |||||| ||||||| ||    
3'    guggg  aguucu guacugu gc   u
   acc     cu      a       a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000094.1: 924361-924419 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8258
ppc-mir-8303-1ABKE03000094.1: 922890-922947 [+]
ppc-mir-8258ABKE03000094.1: 924361-924419 [+]
ppc-mir-8303-2ABKE03000094.1: 924526-924583 [+]
Database links

Mature sequence ppc-miR-8258-5p

Accession MIMAT0032984
Sequence

1 - 

acgcucauucaagaccaugaca

 - 22

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence ppc-miR-8258-3p

Accession MIMAT0032985
Sequence

38 - 

ucaugaucuugaucgggugcca

 - 59

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).