Stem-loop sequence ppc-mir-63k

AccessionMI0026937 (change log)
DescriptionPristionchus pacificus miR-63k stem-loop
Stem-loop
   --c         g  gc        -   --  a 
5'    cgcucacuu ua  gucauggc cca  uc a
      ||||||||| ||  |||||||| |||  ||  
3'    gcgagugaa au  caguaucg ggu  gg u
   gaa         a  -a        u   cu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000028.1: 915983-916046 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63k
ppc-mir-63gABKE03000028.1: 914719-914813 [+]
ppc-mir-63iABKE03000028.1: 915024-915086 [+]
ppc-mir-63hABKE03000028.1: 915178-915286 [+]
ppc-mir-63dABKE03000028.1: 915392-915493 [+]
ppc-mir-63kABKE03000028.1: 915983-916046 [+]
ppc-mir-63eABKE03000028.1: 916252-916352 [+]
Database links

Mature sequence ppc-miR-63k-5p

Accession MIMAT0033018
Sequence

1 - 

ccgcucacuuguagcgucauggc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-63k-3p

Accession MIMAT0033019
Sequence

43 - 

uaugacauaaaagugagcgaag

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).