Stem-loop sequence ppc-mir-8285

AccessionMI0026966 (change log)
DescriptionPristionchus pacificus miR-8285 stem-loop
Stem-loop
   --c   cc       ac    u   ---u  ac 
5'    ccg  ccugcgu  ugac auc    ga  c
      |||  |||||||  |||| |||    ||  c
3'    ggu  ggacgca  acug uag    cu  a
   uua   ua       gu    -   uuau  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000123.1: 4492435-4492497 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-8285
ppc-mir-8285ABKE03000123.1: 4492435-4492497 [-]
ppc-mir-2235a-8ABKE03000123.1: 4492321-4492407 [-]
ppc-mir-2235a-6ABKE03000123.1: 4491870-4491959 [-]
ppc-mir-8286bABKE03000123.1: 4491103-4491158 [-]
ppc-mir-2235a-5ABKE03000123.1: 4490526-4490615 [-]
ppc-mir-2235a-10ABKE03000123.1: 4488083-4488141 [-]
ppc-mir-8286aABKE03000123.1: 4487970-4488029 [-]
ppc-mir-2235a-5ABKE03000123.1: 4487622-4487711 [-]
ppc-mir-2235a-5ABKE03000123.1: 4487174-4487263 [-]
ppc-mir-2235a-7ABKE03000123.1: 4486950-4487039 [-]
ppc-mir-2235a-5ABKE03000123.1: 4486726-4486815 [-]
ppc-mir-2235a-4ABKE03000123.1: 4486502-4486591 [-]
ppc-mir-2235a-5ABKE03000123.1: 4486054-4486143 [-]
ppc-mir-2235a-3ABKE03000123.1: 4485830-4485919 [-]
ppc-mir-2235a-2ABKE03000123.1: 4485382-4485471 [-]
ppc-mir-2235a-1ABKE03000123.1: 4484486-4484575 [-]
ppc-mir-2235a-10ABKE03000123.1: 4483835-4483893 [-]
ppc-mir-8286aABKE03000123.1: 4483722-4483781 [-]
ppc-mir-2235a-10ABKE03000123.1: 4483612-4483670 [-]
ppc-mir-8286aABKE03000123.1: 4483499-4483558 [-]
ppc-mir-2235a-10ABKE03000123.1: 4482948-4483006 [-]
ppc-mir-8286aABKE03000123.1: 4482835-4482894 [-]
ppc-mir-2235a-10ABKE03000123.1: 4482725-4482783 [-]
ppc-mir-8286aABKE03000123.1: 4482612-4482671 [-]
Database links

Mature sequence ppc-miR-8285-5p

Accession MIMAT0033075
Sequence

1 - 

cccgccccugcguacugacuauc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppc-miR-8285-3p

Accession MIMAT0033076
Sequence

42 - 

ugucaugacgcaggauuggauu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).