Stem-loop sequence ppc-mir-8342

AccessionMI0027046 (change log)
DescriptionPristionchus pacificus miR-8342 stem-loop
Stem-loop
   --c      ga    -u  g    g  auauuuua    a 
5'    gaacaa  gcuc  ga cauu gc        guga u
      ||||||  ||||  || |||| ||        ||||  
3'    cuuguu  uggg  cu guaa ug        cgcu g
   caa      -g    uc  g    g  ---agacg    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000123.1: 3678033-3678107 [+]
intergenic
Database links

Mature sequence ppc-miR-8342-5p

Accession MIMAT0033229
Sequence

1 - 

cgaacaagagcucugagcau

 - 20

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ppc-miR-8342-3p

Accession MIMAT0033230
Sequence

57 - 

guccuggguguuguucaac

 - 75

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:23729632 "Conserved miRNAs are candidate post-transcriptional regulators of developmental arrest in free-living and parasitic nematodes" Ahmed R, Chang Z, Younis AE, Langnick C, Li N, Chen W, Brattig N, Dieterich C Genome Biol Evol. 5:1246-1260(2013).